Animal Genetics
::
Animal Genetics
/
Tests
/
Control test
Animal Genetics
Introduction
Key words
Goal
Annotation
Molecular basis of how ge…
Classical Genetics – Basi…
Principles of population …
Genetics of farm animals
Summary
Tests
Solving genetics problems
Control test
Search
Recommended for Coursies
Animal breeding
Animal Genetics
Applied Genetics in Agriculture
Applied Genetics in Agriculture …
Control test
Test questions
Central dogma of molecular genetics is:
Select only one of the following possible answers.
DNA -> protein
DNA -> RNA -> protein
RNA -> protein
(DNA <-> DNA) <-> RNA -> protein
protein -> RNA
_________________ discovered that genes are inherited discretely. In other words, genes from parents do not mix, and are passed on from parent to offspring as discreet units.
Select only one of the following possible answers.
Charles Lyell
Charles Darwin
Gregor Mendel
James Hutton
None of the above
In the ABO blood system in human beings, alleles A and B are codominant and both are dominant to the 0 allele. In a paternity dispute, a type AB woman claimed that one of four men was the father of her type A child. Which of the following men could be the
Select any number of possible answers.
Type A
Type B
Type 0
Type AB
In cattle are 2n = 60. How many chromosomes would you find in: brain cell, erythrocyte and sperm cell?
Select only one of the following possible answers.
60, 0, 30
60, 60, 30
60, 30, 30
30, 30, 30
Here is the sequence of the template strand of a DNA fragment: 5' CATCATTGCACGGCGACTCAACCAT 3'. Which of the following would be the complementary, nontemplate, strand:
Select only one of the following possible answers.
3' TAGGCGACTATGGTTGAGTCGCCGT 5'
3' ATCCGCTGATACCAACTCAGCGGCA 5'
3' GTAGTAACGTGCCGCTGAGTTGGTA 5'
3' CATCATTGCACGGCGACTCAACCAT 5'
Part of a DNA strand, which will be transcribed, has the following sequence: 3' TACTAACTTACGCTCGCCTCA 5'. What is the sequence of amino acids made by the RNA?
Select only one of the following possible answers.
Tyr-Stop
Thr-Pro-Leu-Ala-Phe-Asn-His
Met-Ile-Glu-Lys-Glu-Arg-Ser
All of the following are sources of genetic variation for evolution, except:
Select any number of possible answers.
Mutation
Recombination
Genetic drift
Gene flow / Migration
The equation of Hardy Weinberger genetics equilibrium predicts:
Select any number of possible answers.
allelic frequencies (p, q) will change from generation to generation
allelic frequencies (p, q) will not change from generation to generation
genotypes will occur according of the binomial distribution p2 = f(AA), 2pq = f(Aa) and q2 = f(aa)
impact of mutation, selection and migration on allelic and genotypic frequencies
allelic frequencies in small populations with inbreeding and genetic drift
For estimation of breeding value you need know:
Select any number of possible answers.
phenotypic variance
genetic variance
heritability
kinship between animals (pedigree information)
switch on the computer
From which components is constituted the total phenotypic variance of quantitative trait?
Select any number of possible answers.
V(G)
V(E)
V(G) + V(E)
V(G) + V(E) + V(P)
V(A) + V(D) + V(I) + V(E) + V(GE)
Which of the following statements about living cells is false?
Select only one of the following possible answers.
Most are microscopic
They are found in all animals but not in all plants
c) They are the smallest basic units that can carry out all of the functions that we normally define as life
Chromosomes are found in _____________________ of cells.
Select only one of the following possible answers.
The nucleus
The cytoplasm
Both the nucleus and the cytoplasm
Autosomes:
Select only one of the following possible answers.
are all chromosomes other than the sex chromosomes
are normal sex chromosomes
automatically determine the sex of children
Normal humans have __________ pairs of autosomes and ___________ pairs of sex chromosomes:
Select only one of the following possible answers.
23 and 23
23 and 2
22 and 1
46 and 1
Which of the following statements is true?
Select only one of the following possible answers.
Mitosis produces cells that have a haploid number of chromosomes
Meiosis produces cells that have a diploid number of chromosomes
Meiosis produces cells that have a haploid number of chromosomes
Amino acids are the building blocks of:
Select only one of the following possible answers.
DNA and RNA
lipids
proteins
carbohydrates
_____ copies the coded message from the DNA in the nucleus , and carries the message in the cytoplasm.
Select only one of the following possible answers.
Transfer RNA
Messenger RNA
Ribosomal RNA
Small nuclear RNA
____ carries amino acids and adds them to the growing protein.
Select only one of the following possible answers.
Transfer RNA
Messenger RNA
Ribosomal RNA
Small nuclear RNA
A(n) ____ allele exerts an effect when present in just one copy, while a ____ allele exerts an effect only when present in two copies.
Select only one of the following possible answers.
autosomal; sex
somatic; germline
polygenic; multifactorial
dominant; recessive
Heritability is a measurement that estimates the proportion of _____.
Select only one of the following possible answers.
genetic variation in a group that can be attributed to the environment
phenotypic variation in an individual that can be attributed to genes
phenotypic variation in a certain population that is due to genetic differences within the population
None of the above
A higher heritability would be found for a trait in a population that is _____.
Select any number of possible answers.
homozygous for genes affecting the trait
in a uniform environment
heterozygous for genes affecting the trait
in a heterogeneous environment
The fact that the modified state of chromatin can be passed on when DNA replicates is an example of ____ inheritance.
Select only one of the following possible answers.
epistatic
Mendelian
epigenetic
maternal
A ____ mutation occurs during the DNA replication that precedes meiosis, while a ____ mutation occurs during the DNA replication that precedes mitosis.
Select only one of the following possible answers.
germline; somatic
germline; spontaneous
somatic; germline
spontaneous, point
Changing the codon AGC to AGA represents a ____ mutation.
Select only one of the following possible answers.
missense
nonsense
frameshift
deletion
The reaction that copies target DNA into RNA, then uses an RNA polymerase to amplify the RNA is called _____.
Select only one of the following possible answers.
RNA amplification
nucleic acid amplification
polymerase chain reaction
transcription-mediated amplification
The DNA microarray technology that indicates which genes are transcribed is called _____.
Select only one of the following possible answers.
gene expression profiling
DNA variation screening
antisense
polymerase chain reaction
In the first step of the polymerase chain reaction, _____.
Select only one of the following possible answers.
primers bind by complementary base pairing to the separated target strands
TaqI DNA polymerase adds bases to the primers and builds a sequence complementary to the target sequence
heat is used to separate the two strands of the target DNA
Genome-wide association studies _____.
Select only one of the following possible answers.
relate sequence patterns to the probability of developing a production trait
make use of SNP mapping
are more powerful than heritability studies
all of the above are true in regard to association studies
Replication proceeds in a ____ to ____ direction.
Select only one of the following possible answers.
3'; 3'
3'; 5'
5'; 3'
5'; 5'
____ DNA synthesis produces Okazaki fragments on one strand of the DNA template.
Select only one of the following possible answers.
Continuous
Dispersive
Conservative
Discontinuous
Date last updated: 10. 06. 2013.
Prepared under project CZ.1.07/2.2.00/28.0020
Innovation of study programs FA MENDELU towards internationalization of study